Journal: Investigative ophthalmology & visual science

Article Title: Ecel1 Knockdown With an AAV2-Mediated CRISPR/Cas9 System Promotes Optic Nerve Damage-Induced RGC Death in the Mouse Retina.

doi: 10.1167/iovs.18-23784

Figure Lengend Snippet: FIGURE 2. Optic nerve crush strongly induced Ecel1 expression in the retinas of the mice. (A) qRT-PCR was performed to analyze the Ecel1 mRNA expression level, normalized to Gapdh mRNA (n ¼ 7–11 each group). (B) The protein level of Ecel1 in the retinas was examined with an immunoblot analysis. Beta actin was used as an internal control. (C) Retinal protein was immunolabeled with anti-Ecel1 with or without a blocking peptide. (D) Immunohistochemistry showed that Ecel1 was absent from the retinas of mice that underwent a sham operation, while Ecel1 protein was abundantly expressed in the GCL on day 4 after optic nerve crush. (E) Ecel1 protein was strikingly localized in the mouse GCL on day 4 after optic nerve crush and not in the other cell layers. (F) Histogram showing the number of Ecel1-positive cells in the GCL 4 days after optic nerve crush (n ¼ 4 each group). (G) Immunoreaction for Ecel1 was colocalized with RBPMS, a marker of the RGCs. Error bars denote standard deviation. NC, nerve crush. **P < 0.01, ***P < 0.001. Scale bar: 20 lm.

Article Snippet: To construct adeno-associated virus (AAV) plasmids expressing Staphylococcus aureus Cas9 and single guide RNA sequences under control of the CMV and U6 promoters, respectively, doublestrand DNA oligonucleotides corresponding to the designed guide RNA sequences were inserted into a BsaI recognition site, as follows: pX601-AAV-CMV::NLS-SaCas9-NLS-3xHAbGHpA;U6::BsaI-sgRNA (pX601; a gift from Feng Zhang; Addgene plasmid no. 61591).27 Guide RNA sequences targeting Ecel1 and cyan fluorescent protein (CFP), as a negative control, were used in this study (see Fig. 4A).

Techniques: Expressing, Quantitative RT-PCR, Western Blot, Control, Immunolabeling, Blocking Assay, Immunohistochemistry, Marker, Standard Deviation

Journal: Investigative ophthalmology & visual science

Article Title: Ecel1 Knockdown With an AAV2-Mediated CRISPR/Cas9 System Promotes Optic Nerve Damage-Induced RGC Death in the Mouse Retina.

doi: 10.1167/iovs.18-23784

Figure Lengend Snippet: FIGURE 3. Ecel1 expression was strongly induced in damaged RGCs treated with vinblastine but not in those treated with NMDA. Relative expression levels of Thy-1.2 (A), Rbpms (B), and Ecel1 (C) in vinblastine-treated retinas, and Thy1 (D), Rbpms (E), and Ecel1 (F) in NMDA-treated retinas, were determined with quantitative RT-PCR and normalized to the Gapdh level. Error bars denote SD (vinblastine; n¼7–8, NMDA; n¼6–10 for each group at each time point). Vin, vinblastine. *P < 0.05, **P < 0.01, ***P < 0.001.

Article Snippet: To construct adeno-associated virus (AAV) plasmids expressing Staphylococcus aureus Cas9 and single guide RNA sequences under control of the CMV and U6 promoters, respectively, doublestrand DNA oligonucleotides corresponding to the designed guide RNA sequences were inserted into a BsaI recognition site, as follows: pX601-AAV-CMV::NLS-SaCas9-NLS-3xHAbGHpA;U6::BsaI-sgRNA (pX601; a gift from Feng Zhang; Addgene plasmid no. 61591).27 Guide RNA sequences targeting Ecel1 and cyan fluorescent protein (CFP), as a negative control, were used in this study (see Fig. 4A).

Techniques: Expressing, Quantitative RT-PCR

Journal: Investigative ophthalmology & visual science

Article Title: Ecel1 Knockdown With an AAV2-Mediated CRISPR/Cas9 System Promotes Optic Nerve Damage-Induced RGC Death in the Mouse Retina.

doi: 10.1167/iovs.18-23784

Figure Lengend Snippet: FIGURE 4. Ecel1 knockdown with the CRISPR/Cas9 system promoted RGC loss after optic nerve crush. (A) Structure of the mouse Ecel1 gene; the 2nd exon is magnified. The mouse Ecel1 gene has 18 exons and 17 introns. The translation start codon (ATG) is located on the second exon. The guide RNA sequences for Ecel1 and for CFP as a control are shown in the box. (B) T7 Endonuclease 1 (T7E1) assay revealing genome editing at the Ecel1 locus in sorted mCherry-expressing cells from AAV2-mCherry and AAV2-CRISPR/Cas9-injected retinas. Asterisks indicated indel formation. (C) Mutation pattern sequencing of Ecel1 locus. (D) Immunoblotting with an anti-Ecel1 antibody in retinas injected with AAV2-CRISPR/Cas9 4 days after optic nerve crush. (E) Quantification of Ecel1 protein levels normalized with b-actin in (D) (n ¼ 3 each). (F) Immunostaining images for Ecel1 with AAV2-CRISPR/Cas9-Ecel1 treatment 4 days after optic nerve crush. (G) Histogram showing the number of Ecel1-positive cells in the GCL 4 days after optic nerve crush and treatment with AAV2-CRISPR/Cas9. (H) Representative images of FG-labeled RGCs 7 days after optic nerve crush in mice

Article Snippet: To construct adeno-associated virus (AAV) plasmids expressing Staphylococcus aureus Cas9 and single guide RNA sequences under control of the CMV and U6 promoters, respectively, doublestrand DNA oligonucleotides corresponding to the designed guide RNA sequences were inserted into a BsaI recognition site, as follows: pX601-AAV-CMV::NLS-SaCas9-NLS-3xHAbGHpA;U6::BsaI-sgRNA (pX601; a gift from Feng Zhang; Addgene plasmid no. 61591).27 Guide RNA sequences targeting Ecel1 and cyan fluorescent protein (CFP), as a negative control, were used in this study (see Fig. 4A).

Techniques: Knockdown, CRISPR, Control, Expressing, Injection, Mutagenesis, Sequencing, Western Blot, Immunostaining, Labeling

Journal: bioRxiv

Article Title: In vivo interrogation of transcriptional and epigenetic regulators of lung epithelial regeneration

doi: 10.64898/2026.03.13.711474

Figure Lengend Snippet: (A). Immunofluorescence (IF) images of in vivo AT2 transduction using AAV9. Green: eGFP; Red: proSPC. Yellow arrows indicate the AT2s (proSPC + ) that are infected by AAV9-eGFP. Scale bars, 50 μm. (B). Schematic of the SAGE (AAV-SBase-intron) system. (C). Experimental design for quantification of genome integration efficiency of engineered AAV systems. Lungs were harvested from mice seven days after i.t. administration. (D). Representative widefield images of the organoids grown from AT2s transduced by SAGE. mScarlet + AT2s were harvested as CD45 - Pdgfra - CD31 - EpCAM + MHCII + CD104 - . Scale bars, 200 μm. (E). Quantification for integration efficiency of AAV9 and SAGE using the AT2 clonal organoid assay. N = 3 and 12 mice were used for AAV9 and SAGE, respectively. Error bars: mean ± SEM. (F). IF images illustrating Sftpc gene knockout in AT2s. AT2-specific knockouts were achieved through AT2-Cas9-eGFP mice following tamoxifen treatment and subsequent SAGE gRNA delivery (detailed experimental scheme in ). A gRNA targeting the Tigre locus , a genomic safe harbor in the mouse genome, was used as a control. Green: eGFP representing Cas9 expression; yellow: mScarlet, representing SAGE transduction; cyan, proSPC. White dashed lines indicate AT2s expressing Cas9 and gRNA that have lost proSPC expression. White solid lines indicate AT2s expressing Cas9 and gRNA that have retained proSPC expression. Scale bars, 50 μm. (G). Quantification of proSPC knockout effects in AT2s that are mScarlet + eGFP + . N = 4 mice were used for each condition. Error bars: mean ± SEM.

Article Snippet: In brief, 5 μl of the fraction after ultracentrifugation, isolated AAVs or Addgene AAV standards (Adgene #37825-AAV9) were treated with with DNase I (Merck, 11284932001) at 37 °C for at least 1 hr, followed by Proteinase K digestion at 56 °C for at least 2 hrs before preparing a threefold serial dilutions with ddH2O. qPCR reactions with primers targeting the WPRE region (WPRE_F, CAATCCAGCGGACCTTCCTT; WPRE_rev, AGATCCGACTCGTCTGAGGG) for normal AAVs and the mScarlet region (mScarlet_F, AAGAAGCCCGTGCAGATGCC; mScarlet_R, GCCACGGAGCGTTCGTACTG) for SAGE were performed with 3 μl of the diluted AAV template, 5 μl Power SYBRTM Green PCR Master Mix (Thermo Fisher Scientific, 4368706), 2.5 μM of each primers in a total of 2 μl. qPCR was performed using RioRad CFX 384 system and at conditions as follows: (1) 95 °C for 10 min; (2) 40 cycles of 95 °C for 15 s and 60 °C for 1 min (40 cycles).

Techniques: Immunofluorescence, In Vivo, Transduction, Infection, Gene Knockout, Control, Expressing, Knock-Out

Journal: bioRxiv

Article Title: In vivo interrogation of transcriptional and epigenetic regulators of lung epithelial regeneration

doi: 10.64898/2026.03.13.711474

Figure Lengend Snippet: (A). Two color AAV experiments for quantitative assessment of multi-infection rate for AAV transduction in vivo . Mice were i.t. administered non-engineered eGFP-AAV9: mCherry-AAV9 at 1:1 ratio at indicated total viral loads (4 × 10 9 , 2 × 10 10 , or 1 × 10 11 ) and lungs were harvested five days later. Representative gates were pregated as CD45 - CD31 - Pdgfra - EpCAM + CD104 - MHCII + . (B). Pairwise scatter plots of gRNA abundance in libraries from plasmids, AAVs, and AT2s from biological replicates. (C). Pearson correlation of gRNA abundance in the CM screen derived from plasmids (P), packaged AAV libraries (AAV), and AT2s harvested after injury resolution. Pairwise correlations demonstrate high library representation fidelity across stages. (D). gRNA abundance log 2 fold change (LFC) of control gRNAs and Plk1 gRNAs in the CM and TF screens. Error bars: mean ± SEM. Statistical analysis was using the two-tailed Student’s t -tests. p-values are reported as follows: **p < 0.01.

Article Snippet: In brief, 5 μl of the fraction after ultracentrifugation, isolated AAVs or Addgene AAV standards (Adgene #37825-AAV9) were treated with with DNase I (Merck, 11284932001) at 37 °C for at least 1 hr, followed by Proteinase K digestion at 56 °C for at least 2 hrs before preparing a threefold serial dilutions with ddH2O. qPCR reactions with primers targeting the WPRE region (WPRE_F, CAATCCAGCGGACCTTCCTT; WPRE_rev, AGATCCGACTCGTCTGAGGG) for normal AAVs and the mScarlet region (mScarlet_F, AAGAAGCCCGTGCAGATGCC; mScarlet_R, GCCACGGAGCGTTCGTACTG) for SAGE were performed with 3 μl of the diluted AAV template, 5 μl Power SYBRTM Green PCR Master Mix (Thermo Fisher Scientific, 4368706), 2.5 μM of each primers in a total of 2 μl. qPCR was performed using RioRad CFX 384 system and at conditions as follows: (1) 95 °C for 10 min; (2) 40 cycles of 95 °C for 15 s and 60 °C for 1 min (40 cycles).

Techniques: Infection, Transduction, In Vivo, Derivative Assay, Control, Two Tailed Test

Journal: Communications Biology

Article Title: Exposure to COVID-19 virus-like particles modulates firing patterns of cortical neurons in the mouse brain

doi: 10.1038/s42003-025-08435-8

Figure Lengend Snippet: A Schematic illustration of the experimental setup. Mice were lightly anesthetized, sedated, and received trains of electric stimuli to their hindlimbs while neuronal activity from their motor and somatosensory cortices was recorded using two-photon microscopy. B Example image of S1 neurons expressing jGCaMP7s. scale bar, 50 μm. C Examples of spontaneous and stimulated activity traces (blue and green traces, respectively) from the cells indicated by orange boxes in panel ( B ). Gray bars and lightning signs indicate the times where the paw stimulation was given to the mouse, while dashed vertical lines indicate the separation between stimulation cycles. D Comparison of the fraction of neurons that fired action potentials during the spontaneous activity recordings in S1 and M1 out of all recorded neurons in the same brain region (active neurons), and the median firing rate of the active neurons. The fraction of active neurons was significantly higher in the S1 region of WT mice than that of htau ( p = 0.018, Wilcoxon Rank Sum Test). For the median firing rate panel, each dot is the median across all the recorded active neurons from the same brain region of one mouse. WT median firing rates in S1 and M1 regions were significantly higher than the respective regions in htau mice ( p = 0.0015 and 0.0018, respectively, Wilcoxon Rank Sum Tests). In addition, the median firing rate in M1 of WT mice was significantly higher than that in S1 ( p = 0.02, Wilcoxon Signed-Rank Test). E Comparison of the stimulated activity metrics shows a significant increase in htau vs. WT fraction of M1 neurons that increased their activity during paw stimulation (tuned activity), after the stimulation (sustained activity), or showed both tuned and sustained activity (comparing M1 neurons between WT and htau: p = 0.002 for the three comparisons; Wilcoxon Rank Sum Tests). A similar comparison for the S1 region showed that htau mice had a higher fraction of sustained activity neurons as well as a higher fraction of neurons with both tuned and sustained activity (comparing S1 neurons between WT and htau: left panel: p = 0.15, middle and right panels: p = 0.003; Wilcoxon Rank Sum Tests). In addition, for WT mice, a higher fraction of S1 than M1 neurons was tuned and showed both tuned and sustained activity ( p = 0.016 for both comparisons, Wilcoxon Signed-Rank Tests). 49–708 and 59–1172 neurons were recorded to calculate each data point in ( D ) and ( E ), with median values of 355 and 513 neurons, respectively. For the Wilcoxon Rank Sum Tests data from n = 12 WT and 6 htau mice were used in ( D ) and n = 12 WT and 5 htau mice in ( E ). For the Wilcoxon Signed-Rank Tests we used n = 10 M1 and S1 pairs from WT and 3 pairs from htau mice for ( D ); and n = 7 pairs from WT and 3 pairs from htau mice for ( E ). For both ( D , E ), each dot shows data from one mouse, horizontal bars are the mean per brain region, and error bars span the standard deviation. * p < 0.05; ** p < 0.01.

Article Snippet: An adeno-associated virus (AAV) solution expressing jGCaMP7s under the human synapsin promoter (Addgene catalog number 104487-AAV1, 2.7∗10 13 GC/ml, diluted 1:10 with saline) was injected into the cortex according to mouse brain atlas coordinates (Injection locations anterior/lateral to bregma: M1: two locations, 0.5/−1 mm and −0.5/−1.25 mm, the first location corresponds to the vibrissa and neck, the second location between the forelimb and hindlimb regions (M1 VN and M1 limbs , respectively) according to a microstimulation study ; S1: two locations, −0.5/−1.9 mm and −1.75/−2.5 mm, which correspond to S1 hindlimb and S1 barrel field regions (S HL and S BF , respectively).

Techniques: Activity Assay, Microscopy, Expressing, Comparison, Standard Deviation

Journal: Scientific Reports

Article Title: A protein-RNA interaction atlas of the ribosome biogenesis factor AATF

doi: 10.1038/s41598-019-47552-3

Figure Lengend Snippet: Analysis of AATF-bound RNA biotypes identified by eCLIP. ( A ) Stacked bar colors indicate the fraction of reads mapping to indicated ribosomal RNA, other repeat elements, or uniquely to the human genome. For comparisons the total number of ENCODE datasets were used (223 datasets of 150 RBPs) . All = all datasets, inputs = all input controls, nucleolar = all nucleolar RBPs among the ENCODE datasets, non-nucleolar = all non-nucleolar RBPs among the ENCODE datasets; “unique genomic within Repbase elements” = mapping uniquely to a repeat-masker identified element in the genome, “other repeated sequences” = mapping to the canonical repetitive elements in the family analysis. Nucleolar or non-nucleolar localization of RBPs was based on immunofluorescence data from the ENCODE consortium (see methods section for details). ( B ) Box plot comparison of AATF eCLIP-seq data to input and to 150 ENCODE RBPs showing enrichment of rRNA species in IP (red dot) over input (black circle) is specific for AATF. The other 150 ENCODE RBPs show a decrease of rRNA species in the IP (white box) compared to inputs (grey box). RNA species are plotted against the reads identified per million unique fragments. ( C ) RIP-qPCR analysis of 18S rRNA and 45S pre-rRNA transcripts validating the capacity of AATF to bind rRNA. Full-length FLAG-tagged AATF, the FLAG-tagged AATF 2ΔNoLS truncation or FLAG-tagged RFP (red fluorescent protein) were transiently overexpressed in HEK 293T cells and immunoprecipitated in RNA-interaction preserving conditions. Quantification of co-precipitated rRNA revealed a significant reduction of RNA binding for both ribosomal transcripts after loss of the two NoLS sites. RQ: relative quantification. CT values for WT AATF, 2ΔNoLS AATF and RFP were normalised against the corresponding input (delta CT IP-INPUT ), and consecutively against RFP (delta delta CT, e.g. delta CT AATF − delta CT RFP ). FLAG-RFP served as negative control. Experiments were carried out in three biological replicates, using two technical replicates each. Error bars depict the standard deviation. For western blot of IP from whole cell lysates showing equal protein amounts see Suppl. Fig. . ( D ) Knockdown of AATF leads to a reduction of rRNA. The CDS of AATF was targeted with siRNA in mIMCD3 cells, which induced a significant depletion of endogenous AATF and was accompanied by a decrease in rRNA after 48 h of incubation. Top panel: western blot with anti-AATF antibody. Middle panel: anti-β-tubulin western blot (loading control). Bottom panel: EtBr stained agarose gel. MW: protein molecular weight marker (kDa). ( E ) Expression of AATF single-copy transgene rescues reduction of rRNA in AATF depleted U2OS cells. siRNA against the 3′UTR of AATF was transfected into wild-type U2OS cells and U2OS cells with a TALEN mediated, single-copy integration of GFP-AATF lacking the endogenous 3′UTR into the AAV locus. The 3′UTR specific knockdown of AATF in the wild type cells lead to a reduction of the 18S and 28S rRNA. The expression of the GFP-tagged transgene in the TALEN manufactured U2OS GFP::AATF cell line rescued the amount the rRNA species. Top panel: western blot with anti-AATF antibody. Middle panel: anti-β-tubulin western blot (loading control). Bottom panel: EtBr stained agarose gel. MW: protein molecular weight marker (kDa).

Article Snippet: For the generation of GFP-tagged AATF transgenes and transient overexpression of full-length AATF or 2ΔNoLS truncation, the AATF wild type sequence or the truncated version of it, generated by overlap extension PCR, were cloned into the modified AAV CAGGS GFP plasmid (Addgene #22212) or pcDNA6 (Invitrogen) using restriction enzymes. siRNA duplexes targeting the 3′ UTR of human AATF (accession number AJ249940.2) were custom-designed by Dharmacon.

Techniques: Immunofluorescence, Comparison, Immunoprecipitation, Preserving, RNA Binding Assay, Quantitative Proteomics, Negative Control, Standard Deviation, Western Blot, Knockdown, Incubation, Control, Staining, Agarose Gel Electrophoresis, Molecular Weight, Marker, Expressing, Transfection

Journal: bioRxiv

Article Title: miR-7 controls glutamatergic transmission and neuronal connectivity in a Cdr1as-dependent manner

doi: 10.1101/2023.01.26.525729

Figure Lengend Snippet: (A) Transduction of a glutamate sensor (AAV, Methods) into WT and Cdr1as-KO primary neurons followed by real-time imaging of excitatory synaptic terminals during AP-evoked (20 APs at 0.5 Hz) and spontaneous (5 minutes + 500 nM TTX) release conditions. (B) Quantification of spontaneous glutamate release calculated as spontaneous frequency. Violin plots: integration of the synapses from all animals used (WT: n = 4 animals and 662 synapses; Cdr1as-KO: n = 23 animals and 421 synapses; Methods).Synapses with fluorescence value = 0 were removed. Kernel-Density-Estimate plotted (Methods). Red line: median. P value: Unpaired t-test. (C) Quantification of AP-evoked glutamate release calculated as evoked probability. Violin plots: integration of the synapses from all animals used (WT: n = 4 animals and 335 synapses; Cdr1as-KO: n = 3 animals and 237 synapses; Methods).Synapses with fluorescence value = 0 were removed. Kernel-Density-Estimate plotted (Methods). Red line: median. P value: Unpaired t-test. (D) Schematic representation of the miR-7a overexpression and the mCherry control constructs. Viral transduction performed at DIV7 (AAV, Methods). mCherry became visible at DIV14 and experiments were performed at DIV21. (E) Quantification of miR-7a up-regulation by RNA-Seq (Methods) in WT and Cdr1as-KO neurons at DIV21, 14 days post miR-7a overexpression. Bar plots represents mean of 4 independent biological replicates per genotype. (F) Glutamate secretion assay performed on neuronal media collected from DIV18-21 WT and Cdr1as-KO neurons infected with control or miR-7a overexpression construct. Each dot represents the glutamate concentration quantified in an independent primary culture (WT = 12; WT + miR-7 overexpression = 12; Cdr1as-KO = 12; Cdr1as-KO + mirR-7 overexpression = 24 independent replicates). Glutamate concentrations are calculated based on a glutamate titration curve (Methods, Supplementary material). Baseline concentration of glutamate in control media without cells was 0,28 uM (4612 RLU). Black line: median. P value: two-way ANOVA, all other comparisons were not statistically significant (not shown).

Article Snippet: The sequence of pri-miR-7a was amplified from mouse brain tissue and cloned into an AAV vector (Addgene Plasmid #99126), driven by a neuronal promoter (hSyn1) and expressed together with mCherry fluorescent reporter.

Techniques: Transduction, Imaging, Fluorescence, Over Expression, Construct, RNA Sequencing Assay, Infection, Concentration Assay, Titration

Journal: bioRxiv

Article Title: miR-7 controls glutamatergic transmission and neuronal connectivity in a Cdr1as-dependent manner

doi: 10.1101/2023.01.26.525729

Figure Lengend Snippet: (A) Scheme of the Multi electrode Array recording protocol (Axion Biosystems, CytoView MEA 48, Methods). Second panel: representative image of cultured neurons DIV14 in a recording well. white: electrodes, red: mCherry reporter. Third panel: schematic representation of output data, extracellular field potentials and neuronal network activity. AP: Adaptative threshold 6 SD. Sampling frequency 12.5 kHz. Active electrode selection criteria 5 spikes/minute. (B) Mean Firing Rate: Total number of spikes per single-electrode divided by the duration of the analysis (600s), in Hz. Left panel: each dot represents a single electrode recording from 4 independent primary cultures (WT = 187; WT + miR-7 overexpression = 194; Cdr1as-KO = 189; Cdr1as-KO + miR-7 overexpression = 200 electrodes). Horizontal line: median. Right panel: median value across timepoints with 95% confidence interval is plotted; arrows indicate transduction time (AAV, DIV7) and reporter first visualization (mCherry, DIV14), respectively. P value: two-way ANOVA, all other comparisons were not statistically significant (not shown). (C) Burst Frequency: Total number of single-electrode bursts divided by the duration of the analysis, in Hz. Left and right panels plotted as in (B). (D) Burst Duration: Average time (sec) from the first spike to last spike in a single-electrode burst. Left and right panels plotted as in (B).

Article Snippet: The sequence of pri-miR-7a was amplified from mouse brain tissue and cloned into an AAV vector (Addgene Plasmid #99126), driven by a neuronal promoter (hSyn1) and expressed together with mCherry fluorescent reporter.

Techniques: Cell Culture, Activity Assay, Sampling, Selection, Over Expression, Transduction

Journal: bioRxiv

Article Title: miR-7 controls glutamatergic transmission and neuronal connectivity in a Cdr1as-dependent manner

doi: 10.1101/2023.01.26.525729

Figure Lengend Snippet: (A) Number of Spikes per Burst: Average number of spikes in a single-electrode burst. Left panel: each dot represents a single electrode recording from 4 independent primary cultures (WT = 187; WT + miR-7 overexpression = 194; Cdr1as-KO = 189; Cdr1as-KO + miR-7 overexpression = 200 electrodes). Horizontal line: median. Right panel: median value across timepoints with 95% confidence interval is plotted; arrows indicate transduction time (AAV, DIV7) and reporter first visualization (mCherry, DIV14), respectively. P value: two-way ANOVA, all other comparisons were non-statistically significant (not shown). (B) Burst Percentage: number of spikes in single-electrode bursts divided by the total number of spikes, multiplied by 100. Left and right panels plotted as in (A). (C) Example raw spikes from multi electrodes Array recording: 100 ms raw spikes of WT and Cdr1as-KO neurons DIV21. Each row represents one independent electrode (blac bars).

Article Snippet: The sequence of pri-miR-7a was amplified from mouse brain tissue and cloned into an AAV vector (Addgene Plasmid #99126), driven by a neuronal promoter (hSyn1) and expressed together with mCherry fluorescent reporter.

Techniques: Over Expression, Transduction

Journal: bioRxiv

Article Title: miR-7 controls glutamatergic transmission and neuronal connectivity in a Cdr1as-dependent manner

doi: 10.1101/2023.01.26.525729

Figure Lengend Snippet: (A) Asynchrony: The ability of neurons to generate APs simultaneously was calculated as area under the well-wide pooled inter-electrode cross-correlation. Higher areas indicate lower synchrony ( , Methods). Left panel: each dot represents a network recording (Methods) from 4 independent primary cultures (WT = 11; WT + miR-7 overexpression = 26; Cdr1as-KO = 12; Cdr1as-KO + miR-7 overexpression = 28 electrodes). Horizontal line: median. Right panel: median across timepoints with 95% CI plotted, arrows indicate transduction time (AAV, DIV7) and reporter first visualization (mCherry, DIV14). All metrics apply to network bursts across single wells within 20 ms. P value: two-way ANOVA, all other comparisons were not statistically significant (not shown). (B) Oscillation: Average across network bursts of the inter spike interval coefficient of variation (ISI CoV) (standard deviation/mean of the inter-spike interval) within network bursts. Oscillation is a measure of how the spikes from all of the neurons are organized in time. WT = 11-26; Cdr1as-KO: 12-28 independent network recordings. Left and right panels plotted as in (A). (C) Burst Peak: Maximum number of spikes per second in the average network burst. The peak of the average network burst histogram divided by the histogram bin size to yield spikes per sec (Hz). WT = 11-26; Cdr1as-KO: 12-28 independent network recordings. Left and right panels plotted as in (A).

Article Snippet: The sequence of pri-miR-7a was amplified from mouse brain tissue and cloned into an AAV vector (Addgene Plasmid #99126), driven by a neuronal promoter (hSyn1) and expressed together with mCherry fluorescent reporter.

Techniques: Over Expression, Transduction, Standard Deviation